Home APASdb Home APAS Search APAS Browse BLAST Download Contact Us Help Citation
Analysis of genomic poly(A) sites
  Search For [ Example ] [ Tips ]
Sequence obtaned by the ids from the miRNA-dataset: 'Danio.rerio_mature.miRNA'
Strand:  Forwstrand Revcstrand  Display:  Fasta Numbered
Current detected sequences from to
 
[1]. >dre-miR-430a|MIMAT0001423  No description  Required:1-22bp in 1-22bp
TAAGTGCTATTTGTTGGGGTAG

 
Jan 11, 2021. Last updated  
Copyright© Laboratory of Molecular Medicine, Sun Yat-Sen University, High Education Mega Center, Guangzhou 510006 China.