Home APASdb Home APAS Search APAS Browse BLAST Download Contact Us Help Citation
Analysis of genomic poly(A) sites
  Search For [ Example ] [ Tips ]
  
 Searching for Transcripts 
[Help]  
 
Mouse
Mus musculus
 Database: for
 Tips for searching: search using a ID, gene name, symbols or description variable in publications and databases.
 Searching examples: ssr4, ssr, hox, TLR, caspase, also Bb_073760F are available for query.
 

 1. Transcript Detail [Help]   
 Transcript Mapping
 Exons Structure     

Gene id: uc009dsc.2 
Gene name: Cdca3
Chromosome: chr6(+)
Gene locus: chr6(+):124780193-124783719
Gene description: cell division cycle-associated protein 3

Transcript id: uc009dsc.2 
Transcript name: Cdca3
Transcript locus: chr6(+):124780193-124783719

Start codon: 124780549
Stop codon: 124783156
Alternative polyA sites: Mapped to the searched transcript (containing the 5' and 3' flanking region of 1kb).
124780019, 124783293, 124783393, 124783545, 124783718
polyA signals: AATGAA, multi, none, CATAAA, none

Notes:
mRNA/CDS:
  mRNA/CDS sequence ( exon splicing-sites gapped by the sympol ' / ' )     
>uc009dsc.2 1488bp 
TAGGGTCGGGGCAGGGGGCGTGGAGGGAAGTTTGAAACTCCGGGCTTTGGGAGTTATTTCTCTAGCTGGTGTTCGGGCAGAGGTCGAGCTGGGGCCCG/CCGGGCCCCGTCCCCAGCCCCAGTGGAGATGGGTTCGACTCAGAGCGTCTCAGGCACTCCAGCACGGCCTCTGCCACGCAACAAGCAAGTGGCTCGAGTAGCAGACCCTCGTTCACCTAGTGCTGGCATCCAGCGCACTCCTATTCAG/GTAGAGAGCTCTCCACAGCCAAGCCTACCAGCAGAACAGCTGAACGGTCTCAAACAGGCACAAGACCCAGATCCCCGCTCTCCTACTCTTGGCATTGCACGGACACCCATGAAGATCAGTGGTCCAG/ACCCTCAGTGCTCACTGGTGAAAGAGCTGAGCGAAGTATTGGAGACAGAAGCGTCGGAATCGATTTCCTCCCCAGAGCTTGCTCTGCCCCGGGAAACGCCTTTATTTTATGACCTGGACCTGTCTTCAGATCCTCAGTTATCCCCTGAGGACCAGTTACTGCCTTGGAGCCAGGCTGAACTCGATCCCAAACAGGTGTTTACCAAGGAGGAAGCCAAACAATCCGCAGAAACTATAGCTGCCAGCCAGAACTCAGACAAGCCCTCCAGAGACCCAGAGACTCCCCAGTCCTCAG/GTTCTAAGCGCAGCAGACGAAAAGCAAACAGCAAGGTTCTAGGGAGGTCCCCTCTCACCATCCTGCAGGATGACAACTCCCCTGGGACCTTGACACTACGACAG/GGTAAGCGGCCTTCTGCCCTCAGTGAGAACGTTAAGGACCTAAAGGAAGGAGTCGTTCTTGGAACTGGAAGATTTCTCAAAGCTGGAGGAGGAGCACGGGAGCCAAACCAGGACCACGACAAGGAAAATCAGCATTTTGCCTTGTTGGAGAGCTAGGGCTGTGCTGGAGTCATCCCCAAGGGCACCAAAGAAAGCCCTGTTCTGATTCCTCTCAGGCACCAACTCTGGTACTTGGACATCGTTCTTTTAAAATGTTTTATGTGTTTCCTGTATATTAAAGTAGATGATTTTAAATGATGCTTTAAGAAGTTAGAGCAAAGCTACACCGGGTCTTGTGTGTATAGAATGGCATCCTAGGGGCCTGTGAGACCTGGATAGATCTCTCTCCTGCCACTTCTGAGCCTCCTTTATGTAGCTTAAGCTTTGATGTCCCCAGAGCTCTGCCTTTGGCCCTCTTCACTTCTTGTTTGGGTTTAGCTATTGCTTACCTGCTTGTAATTTCCAGGTCCCCCTCTCGACATAAACACTCAACGTTAGTTCCCCTAAAATAAGATTCATGATCTTTCCCTCATTGCCTACGCCTCTCCCTGTGGCTGGGGAAAGGTGGTCATCTCCTAGCTACTCAAGCCTAAGCCTCGGCTTTGGGCATCATATTGAACATGACGTGTCTGTGAGGTTGTCACTAGGGCCTGGTGATTATATATTCTTGTCGTCTTC
Protein product:
  Amino acids sequence (deduced by the coding sequence)  
>uc009dsc.2 Cdca3 267aa
MGSTQSVSGTPARPLPRNKQVARVADPRSPSAGIQRTPIQVESSPQPSLPAEQLNGLKQAQDPDPRSPTLGIARTPMKISGPDPQCSLVKELSEVLETEASESISSPELALPRETPLFYDLDLSSDPQLSPEDQLLPWSQAELDPKQVFTKEEAKQSAETIAASQNSDKPSRDPETPQSSGSKRSRRKANSKVLGRSPLTILQDDNSPGTLTLRQGKRPSALSENVKDLKEGVVLGTGRFLKAGGGAREPNQDHDKENQHFALLES*
Citation:
(Leiming You, et al. Nucleic Acids Res. 2015, 43: D59-D67) APASdb: a database describing alternative poly(A) sites and selection of heterogeneous cleavage sites downstream of poly(A) signals.

 
May 19, 2019. Last updated  
Copyright© Laboratory of Molecular Medicine, Sun Yat-Sen University, High Education Mega Center, Guangzhou 510006 China.