Home APASdb Home APAS Search APAS Browse BLAST Download Contact Us Help Citation
Analysis of genomic poly(A) sites
  Search For [ Example ] [ Tips ]
  
 Searching for Transcripts 
[Help]  
 
Lancelet
Branchiostoma belcheri
 Database: for
 Tips for searching: search using a ID, gene name, symbols or description variable in publications and databases.
 Searching examples: ssr4, ssr, hox, TLR, caspase, also Bb_073760F are available for query.
 

 1. Transcript Detail Expression Pattern Orthologs among Species [Help]   
 Transcript Mapping
 Exons Structure     

Gene id: Bb_210760F 
Gene name: tlr22
Chromosome: Sc0000236(+)
Gene locus: Sc0000236(+):159608-163767
Gene description: toll-like receptor 22

Transcript id: Bb_210760F 
Transcript name: tlr22
Transcript locus: Sc0000236(+):159608-163767

Start codon: 159608
Stop codon: 163765
Alternative polyA sites: Mapped to the searched transcript (containing the 5' and 3' flanking region of 1kb).
158734, 164210
polyA signals: TATAAA, ATTAAA

Notes:
  GO annotation matched    
 GO Id Ontology Term
 QuickGO:0031224  Cellular Component  intrinsic to membrane 
 QuickGO:0007165  Biological Process  signal transduction 
 QuickGO:0004888  Molecular Function  transmembrane receptor activity 
 QuickGO:0005515  Molecular Function  protein binding 
  InterPro protein Families and Domains annotation matched 
 InterPro/Pfam Id  Locus  E-value  Description
  IPR001611  135-188  3.4E-13  Leucine-rich repeat
  IPR026906  194-264  0.0022  Leucine rich repeat 5
  IPR001611  472-530  2.9E-14  Leucine-rich repeat
  IPR001611  684-730  1.9E-12  Leucine-rich repeat
  IPR001611  736-793  1.1E-9  Leucine-rich repeat
  IPR000157  956-1094  6.7E-19  Toll/interleukin-1 receptor homology (TIR) domain
  KEGG annotation matched  
 KEGG Id Definition
 KO:K05401   toll-like recepto 
mRNA/CDS:
  mRNA/CDS sequence ( exon splicing-sites gapped by the sympol ' / ' )     
>Bb_210760F 3576bp 
ATGAAACCCTACATGTGCCGTATTTTACGGACATATGTCACGCTAACTAAGCGCTCTGTTGCGTACTCCACGGTATACATTCCTGACTTTCCCCCACAACATGTCCTTTTGTTCTCTGAGTCTGATCCGAATCCTTCTGACAGCGAG/GTTCACACCAAAACGAATCAAACAAAACAGTTAAAAAACATGGAGTCTACCCCCGCTCTTCTCGCAGTCTGCTTGGCTGTGGTTTCAGCGTTCATCGCCCAACATGGACAAGTTAGAGGGCAACTCCCCCCGCCTGTGTGCCAGACATGGAACTCAACAACTGTGGTGTGTACCGGAGTATATAATCCATGGTACGAAAAATCAGACAAAGCACTTCTAACCGAGGTACCGCCTGGCATCCCCAAGTCTGTCATCACGGTGGAGCTCACTAAAAACAACATAACCGAACTGTACAACTTCTCGTTTAGTGGGTTAAGAAATCTGAGACACTTAGTCCTGTATAGAAATAATCTACAGACGATCGAGGTTGGTACGTTCGCAGGGTTGGAGAATTTAGAACATCTTGATTTGCGCGGGTGGATTGTACCTGTACCAAATCCCCTGTTTTCTCTTCAAAATGGACTTTTCCAAGATCTGCGAAACCTGAACTACCTGGCCGTGATGACCTTAACCGATTCGGTCAGTGAGGGAGTGTTCAGGGGCTTATCTAAACTGACGCATTTAGAACTCACTGTGAAAAACAGCAGCAATTTTCCCGATCACATTTTTGATTCATTGACTTCCTTGGAAAGCATTGACATAAGAGAATTTTGCAGGCCCAGTCCAGTGATCCACAGCGGAAGCAAGTTCTTACTACGACGCCTGTTGTGGGAACCGCTGTACAAACTTAAAAAGTTGAAAGTCTATTTTTGTCTGCCAAGAGTCGGTGACATGTATTTTGGTCCTGTATTTAAAAACCTATCTAAATTACAGACAGTAGAAATTTCCTTTTCCATGCATCCTCCGAGTTTTACTGTTCAGATGTTTCAGCCACTGTTACTTACTCTGAAACATTTACTCCTTGGTGAGGGTAGGAAGCTAGAACCCGGCCTGCTGAAGTCATTGACACATCTTCAGACGATGGACCTCCGCCAACTTTTAGATGCCAACATTATGGACATTCTGCCTGAACTTGAATACACGCAGATTCAGAAGCTGTACATGTCATTTTCCATGCAACAAATTAACAAAACGATTACGTCTGATACTTTAGCAGGAATAGAAGGTCTGAAATATTTAAAAGATCTGTTTTTAAATTTAGGTTATTCAGACTTTCGAGGCATAAAATCTAACGCCTTTGCAGGTTTGCAACGTATACAAAAGCTGGATTTTTTTCTGGGCCGATTGGCCATTTTACCAAACAAGACGTTCAGCGGACTGTCCTCGCTCACGCATCTTAACTTGAGCTATAATCACGTCTTTACCTTACGACAAGGCGTGTTTCAAGGATTGTTCTCACTCACTCATCTTGACCTGGCACATAACTCAATTTCTACTTTACCAAGAGGCATATTTGAGGACCTAACCTCTCTTACTCATCTTGATGTGAGCAAAAATGAATTGGTAACCTCCCAGGCTCAGCTTCCAGAGACCATGGACTATCTTGATCTCAGTCAGAATAACTTAAACAGCAGATACGAAAGAGAAAAGCAATGGATATGCCGCAACCCAGTATCATTTAACTTCAGTGGTTTAAACAGTGTAAATCATCTGAATTTGAGTCATAACGCAATTACTGTTGTAGATGGCGGTTGTCTACCTTGGCATTCGTATGCTATGTTTATTGTACACGTTATTGACTTAAGCCACAACAATATTGGAATCTTGGATACCGAAATTTACTGCATGGTGTATTTACAGTACCTCGACCTTTCATTCAACCGCATCAACTCTTTTGATAATTATGGACTGCCATGTGGGCAATCAACATTAGTAACACTTAGGCTGGATAACAATGCTATACAACGTATAATATTGGATCACGTCGATTACCTACTGAGTCCACAACCAAAATCACTGATAAACCTAAAGACATTGACTCTTTCTCAAAATCGCATTCAGCGTATCGAGACAGGACAATTCAGTCGGTTGGTCCGGCTGGAACATCTGGATCTCAGTCATAACGAGATCAATACCGTCATGCCATCCGCCTTCCGTGGACTTTATGATAATGTATCACGGTTAACATTCCTGGATCTCAGTGACAACCAAATACAAACTGTCACAATGATGACATTTGACGGTCTGAAGAATCTTAGGCATCTAAACCTGGCAGCCAACAGGATAGCAGAGATCGGCAACGCTCTTAACCATCTGTACATGTTGAGGAATTTGATTCTGAGCAGAAACAGGATGGCTGTATTAAATCAAACAACATTGGGTCCTGTTGTCTACCGGGTAGAGACTATCGACATTGCAGACAACCCGTTTCTGTGTGACTGTAACTTGATGTGGTTTGTTGAGTGGGCCCAGCAAAAATACGACAGGGTGCCGAACTTGTACAACCCTTATCCTGACTTTGGTCGAAGCTACAATTGCTCCCTTCCAGCTCGTCTGCGTGGACGACGTTTGATAGAAGGGTTGATGCAGAAAGAACAACCGAACGACAGAAATGATCCATCGGAAAGAATGTTCTTCGACACAGACTGTAGTCATGGATTCCGGCCCAACCGCCTCCTGGCTTGTGTACTCGCCTCTTCGGGCATCTTCCTCACCATGATGACCATTTTCCTGGTCGACTACAACATCGGCCGTGTTCAGTACTACCTGTGGATGTTGGCCAAATGGAGGAGACCGGGGATTGGAGAGGTAAGGAACCAAGAGCCGCCCAGATACACGCACGATGCTTTTCTTGCCTACAACAACCGGGACGTCCGGTGGGTTATACATGAAGCAATAGAGAATCTTGAGCCGGAATACAGTCTGGTCATACACGAAAGGGACTTTGCAGTCGGTGCTCCCATTGTGGAAAACATCGCGGATGCCGTGACAAACAGCCGGAGAACCGTCTGCCTCATCACCAGGAACTTCCTGAAGAGTAAGTGGTGCGAGTACGAGTTCCAGCTGGCCCAGTACCACATGTTTGAGGAGGGGGGAGGGGTGCGTCTCATCCTGGTGCTTTTGGAGAGGATTCCTGACCAAATGTTGAAACGGTTCCGCCATTTGAACGCCGTTATAAAGAGGGACACGTACCTGACGTGGCCTCACGACGTGCGGAAAAGGCCGCTGTTCTGGAGGCGACTGCGAGACGCTCTGGGCGATCCGCTGCCCCGGGACCCAGACCCTCAGCTGCACGGACAGGATCAGGAACGGAACATTCCGGAACAGGAGCCACAAGCTCCTGGACGAAATATTCCTGAACAGCAGGCACGAGCTCCAATTAGGATCATTCCAGAACAGCAAGAACAGGCTCGGGCTAGGAACATTGCCGAAGTGCAGGTACATGGCCCCATGCAAAATATTCAGGAAGTGCAAGATGAAATTCCATTGCGAGATGCCAACTACCAGTGGTTTGAAGATGAAGATGATATGCCTCTTCTACCACTGTAG
Protein product:
  Amino acids sequence (deduced by the coding sequence)  
>Bb_210760F tlr22 1192aa
MKPYMCRILRTYVTLTKRSVAYSTVYIPDFPPQHVLLFSESDPNPSDSEVHTKTNQTKQLKNMESTPALLAVCLAVVSAFIAQHGQVRGQLPPPVCQTWNSTTVVCTGVYNPWYEKSDKALLTEVPPGIPKSVITVELTKNNITELYNFSFSGLRNLRHLVLYRNNLQTIEVGTFAGLENLEHLDLRGWIVPVPNPLFSLQNGLFQDLRNLNYLAVMTLTDSVSEGVFRGLSKLTHLELTVKNSSNFPDHIFDSLTSLESIDIREFCRPSPVIHSGSKFLLRRLLWEPLYKLKKLKVYFCLPRVGDMYFGPVFKNLSKLQTVEISFSMHPPSFTVQMFQPLLLTLKHLLLGEGRKLEPGLLKSLTHLQTMDLRQLLDANIMDILPELEYTQIQKLYMSFSMQQINKTITSDTLAGIEGLKYLKDLFLNLGYSDFRGIKSNAFAGLQRIQKLDFFLGRLAILPNKTFSGLSSLTHLNLSYNHVFTLRQGVFQGLFSLTHLDLAHNSISTLPRGIFEDLTSLTHLDVSKNELVTSQAQLPETMDYLDLSQNNLNSRYEREKQWICRNPVSFNFSGLNSVNHLNLSHNAITVVDGGCLPWHSYAMFIVHVIDLSHNNIGILDTEIYCMVYLQYLDLSFNRINSFDNYGLPCGQSTLVTLRLDNNAIQRIILDHVDYLLSPQPKSLINLKTLTLSQNRIQRIETGQFSRLVRLEHLDLSHNEINTVMPSAFRGLYDNVSRLTFLDLSDNQIQTVTMMTFDGLKNLRHLNLAANRIAEIGNALNHLYMLRNLILSRNRMAVLNQTTLGPVVYRVETIDIADNPFLCDCNLMWFVEWAQQKYDRVPNLYNPYPDFGRSYNCSLPARLRGRRLIEGLMQKEQPNDRNDPSERMFFDTDCSHGFRPNRLLACVLASSGIFLTMMTIFLVDYNIGRVQYYLWMLAKWRRPGIGEVRNQEPPRYTHDAFLAYNNRDVRWVIHEAIENLEPEYSLVIHERDFAVGAPIVENIADAVTNSRRTVCLITRNFLKSKWCEYEFQLAQYHMFEEGGGVRLILVLLERIPDQMLKRFRHLNAVIKRDTYLTWPHDVRKRPLFWRRLRDALGDPLPRDPDPQLHGQDQERNIPEQEPQAPGRNIPEQQARAPIRIIPEQQEQARARNIAEVQVHGPMQNIQEVQDEIPLRDANYQWFEDEDDMPLLPL*
Bb_210760F tlr22 ,toll-like receptor 22.
 
 
 
Citation:
(Leiming You, et al. Nucleic Acids Res. 2015, 43: D59-D67) APASdb: a database describing alternative poly(A) sites and selection of heterogeneous cleavage sites downstream of poly(A) signals.

 
May 19, 2019. Last updated  
Copyright© Laboratory of Molecular Medicine, Sun Yat-Sen University, High Education Mega Center, Guangzhou 510006 China.