Home APASdb Home APAS Search APAS Browse BLAST Download Contact Us Help Citation
Analysis of genomic poly(A) sites
  Search For [ Example ] [ Tips ]
  
 Searching for Transcripts 
[Help]  
 
Lancelet
Branchiostoma belcheri
 Database: for
 Tips for searching: search using a ID, gene name, symbols or description variable in publications and databases.
 Searching examples: ssr4, ssr, hox, TLR, caspase, also Bb_073760F are available for query.
 

 1. Transcript Detail Expression Pattern Orthologs among Species [Help]   
 Transcript Mapping
 Exons Structure     

Gene id: Bb_133170F 
Gene name: Ssrp1
Chromosome: Sc0000088(+)
Gene locus: Sc0000088(+):78576-87585
Gene description: structure specific recognition protein 1

Transcript id: Bb_133170F 
Transcript name: Ssrp1
Transcript locus: Sc0000088(+):78576-87585

Start codon: 78576
Stop codon: 87583
Alternative polyA sites: Mapped to the searched transcript (containing the 5' and 3' flanking region of 1kb).
85969, 86994, 88203
polyA signals: none, none, AATAAA

Notes:
  GO annotation matched    
 GO Id Ontology Term
 QuickGO:0003677  Molecular Function  DNA binding 
 QuickGO:0005634  Cellular Component  nucleus 
 QuickGO:0005515  Molecular Function  protein binding 
  InterPro protein Families and Domains annotation matched 
 InterPro/Pfam Id  Locus  E-value  Description
  IPR024954  76-285  1.3E-90  SSRP1 domain
  IPR013719  342-429  2.1E-25  Domain of unknown function DUF1747
  IPR009071  554-622  3.2E-22  High mobility group box domain
  KEGG annotation matched  
 KEGG Id Definition
 KO:K09272   structure-specific recognition protein 
mRNA/CDS:
  mRNA/CDS sequence ( exon splicing-sites gapped by the sympol ' / ' )     
>Bb_133170F 2220bp 
ATGTCCGGGGATACTTTAGAATTCGACCAAATTTTTCAAGAAAATAAAGGCGCCATG/TATGATGGCAGACTTCGCATCACCAAGCAGGGAATCGTCTTCAAGAACAACAAGACAGGAAAGGTCGATAACCTGGCGGGCACTGACCTGAACTTGACCCACTGGTTCAGGGTCGCCAGAGGTTACGAGCTGAAGGTCGGCCTCAAGTCTGGAGCAGTCTTCAAGTACGATGGGTTCAAGGAGTCG/GACTTTGACAAACTGTCGGACTTCATCAATAAGAACTACAAAATGCGTCTTGAGGAGAAGGAGCTGTCAGTCAAAGGCTGGAACTGGGGAACTGCCAAGTTCAAAG/GCCCTTTGCTGTCCTTCGACATTGACAACATGTCTGCGTTTGAGGTCCCGCTGGGGAACGTCTCCCACTGCGCCACGTCCAAGAACGAGGTCGCGCTGGAGTTCCACCAGAACGACGACGCAGACGTGTCGCTCATGGAGATGAGATTCTACGTCCCGCCCAATCAGGACAACCCAGACATAGACCCAGTCCAG/GCTTTCCATGATAATGTGATGGACAAGGCAGACATCATCCAGGCCACTGGAGACGCCATCTGTATCTTTAAGGAACTCCAGTGTCTTACACCAAG/AGGCAGATATGATGTGCGTATCTACCCCACCTTCCTACATCTCCATGGAAAGACGTTTGACTACAAGCTGCCTTACACGACAGTCCTGCGCCTCTTCCTTCTCCCACACAAGGACCAGCGACAAATGTTCTTTGTG/GTTAGTCTGGATCCCCCCATCAAACAAGGCCAGACCAGATACCACTTCCTCATCCTGCAGTTCAGTAAGGATGAGGACATGACCTTGGAGCTCAGCCTGTCAGA/GGAGGACTGTGCGGATAAGTTTGATGGAAAGCTGCAGAAGGAGATGTCAGGCCCCGTGTACGAGATCGTCAGCAGAGTCATGAAGTCCATGGTCAACAGGAAGATCACAGTTCCCGGGGGCTTCAAGGG/TAACTCCGGCACCAGTGCGGTCAGTTGTTCTCACAAGGCCGGTGCAGGGTTCCTGTACCCTCTGGAGAGGGGTTTCATCTACGTGCACAAGCCGCCCATCCACCTCCGCTTCGACGAGATCTCGTGCGTAAACTTTGCTCGAGGCGTCGCCAGCAACAGGACGTTTGACTTCGAGATTGAGACCAAGTCTGGAACCACCTACACCTTCAGCAGTATTGAAAA/GGAGGAGTATGGCAAACTGTTTGACTTTACCACCAATAAAAAGCTCCGAGTCAAAAACAGAGGAAAGAACCTG/AAGGACAGTGTGAACTATGATGAGGACATGATGGGCAGTGATGATGAGGGCCAGCATGATGCCTACATGGAGAGGGTGAAGGCAGAGGCAGCCGAGGGCATCAGTGATGAGGACGAGTCTTCTGATGATG/AAGAGGAGGATGCAGACTTTAACCCAGACGGCAGCGGGAGTGACATCGCTGAGGAGTATGACAGTAACGCCTCCATCTCCTCCAGTGATGATGATGAGGAGGATGAGGAGAAGAAGGAGCGCAGGAAGAAGAAACTGGAGAAGGCCAAGAACAAACCTGCCAAGAGAAAGAGGGCATCG/GACGGAGGAAGGAAGCGTAAGAAGAGGCAGAAGAAAGACCCGAACGCCCCCAAGAAGGCCATGACGGCGTTCATGATCTGGCTCAATGCCACTAGAAGTGATCTGCGCAAGGAAAATCCTGACGCTAGCATTGGTGAGATCGGGAAAATCGCTGGGGAGAAATGGCGGGAGATGGGTCCATCAGACAAAGAG/GAATGGGAGCAGAAGGCAAAGGAAGACAAGGAGCGCTACAAGGCAGCCATGGAGGAATACGAGGCCAGGAAGGCAGAGGAGGGCAGCAGTGGGGGGGAAGAGAGCGACCAGTCCGAGAAAAAGAAGAG/TAAAAAGAGCAGGTCCAGCCGACCCAAACCCAGCCCTACCAAAAGCCCAAGTAAGGCCGGCTCAGGGGCTAACTACAAGAGTAAGGAGTACATCAGTAGTGACAGCGACAGTGACTCCAGTAACAGCGACAGTGAAAGTGAGGAGAAGGAGAAGAAGTCAAAGAAGAAAGGAAAGAAGGCCAAGAAG/AAGTCAGAAGATGAAGAAGAGGAGCCCATAGCCAGCACACCGCCGGAGTCAGAGGAGTCAGCATCCGGTGGAGAGGAGGAGGAGGATGAAGATGATGATTGA
Protein product:
  Amino acids sequence (deduced by the coding sequence)  
>Bb_133170F Ssrp1 740aa
MSGDTLEFDQIFQENKGAMYDGRLRITKQGIVFKNNKTGKVDNLAGTDLNLTHWFRVARGYELKVGLKSGAVFKYDGFKESDFDKLSDFINKNYKMRLEEKELSVKGWNWGTAKFKGPLLSFDIDNMSAFEVPLGNVSHCATSKNEVALEFHQNDDADVSLMEMRFYVPPNQDNPDIDPVQAFHDNVMDKADIIQATGDAICIFKELQCLTPRGRYDVRIYPTFLHLHGKTFDYKLPYTTVLRLFLLPHKDQRQMFFVVSLDPPIKQGQTRYHFLILQFSKDEDMTLELSLSEEDCADKFDGKLQKEMSGPVYEIVSRVMKSMVNRKITVPGGFKGNSGTSAVSCSHKAGAGFLYPLERGFIYVHKPPIHLRFDEISCVNFARGVASNRTFDFEIETKSGTTYTFSSIEKEEYGKLFDFTTNKKLRVKNRGKNLKDSVNYDEDMMGSDDEGQHDAYMERVKAEAAEGISDEDESSDDEEEDADFNPDGSGSDIAEEYDSNASISSSDDDEEDEEKKERRKKKLEKAKNKPAKRKRASDGGRKRKKRQKKDPNAPKKAMTAFMIWLNATRSDLRKENPDASIGEIGKIAGEKWREMGPSDKEEWEQKAKEDKERYKAAMEEYEARKAEEGSSGGEESDQSEKKKSKKSRSSRPKPSPTKSPSKAGSGANYKSKEYISSDSDSDSSNSDSESEEKEKKSKKKGKKAKKKSEDEEEEPIASTPPESEESASGGEEEEDEDDD*
Bb_133170F Ssrp1 ,structure specific recognition protein 1.
 
 
 
Citation:
(Leiming You, et al. Nucleic Acids Res. 2015, 43: D59-D67) APASdb: a database describing alternative poly(A) sites and selection of heterogeneous cleavage sites downstream of poly(A) signals.

 
May 27, 2016. last modified
 
Copyright © Laboratory of Molecular Medicine, Sun Yat-Sen University, High Education Mega Center, Guangzhou 510006 China.