Home APASdb Home APAS Search APAS Browse BLAST Download Contact Us Help Citation
Analysis of genomic poly(A) sites
  Search For [ Example ] [ Tips ]
Sequence obtaned by the ids from the miRNA-dataset: 'B.floridae_mature.miRNA'
Strand:  Forwstrand Revcstrand  Display:  Fasta Numbered
Current detected sequences from to
 
[1]. >bfl-miR-2058|MIMAT0009984  No description  Required:1-24bp in 1-24bp
TGAGAAGTAAGACTACCATCCCGT

 
May 27, 2016. last modified
 
Copyright © Laboratory of Molecular Medicine, Sun Yat-Sen University, High Education Mega Center, Guangzhou 510006 China.