Home APASdb Home APAS Search APAS Browse BLAST Download Contact Us Help Citation
Analysis of genomic poly(A) sites
  Search For [ Example ] [ Tips ]
Sequence obtaned by the ids from the ncRNA-dataset: 'Danio.rerio_Zv9.62.ncRNA'
Strand:  Forwstrand Revcstrand  Display:  Fasta Numbered
Current detected sequences from to
 
[1]. >ENSDART00000128920 ncrna:miRNA scaffold:Zv9:Zv9_scaffold3494:181821:181904:-1 gene:ENSDARG00000091283  Required:1-84bp in 1-84bp
 1 TACAGCCATACCACCCTGGAAATGCCCGATCTCATCTGAACTCGGAAGTAAAGCAGGGTCGGGCCTGGTTAGTACTTGGATGGG 84

 
May 19, 2019. Last updated  
Copyright© Laboratory of Molecular Medicine, Sun Yat-Sen University, High Education Mega Center, Guangzhou 510006 China.