Home APASdb Home APAS Search APAS Browse BLAST Download Contact Us Help Citation
Analysis of genomic poly(A) sites
  Search For [ Example ] [ Tips ]
Sequence obtained by querying the dataset: ESTs/B.belcheri_454EST_xiamen-beihai.merged
Strand:  Forwstrand Revcstrand  Display:  Fasta Numbered
Current detected sequences from to

>est_xb_1526:1-2206 No definition line found  
GACCATTTCTCTTTCTTCCTAACTAAATTTCTGCGCACAAATATACAATAAGATTTCAATTTGAAAGAAATATACAGGTAGACTTTCAGTTCATATTCTT
ACACCGAACTAACAAACTTTTCTCCTTTCTACTAAATCATCAATTTGAATTATTTTCTGATTTGACTCAGAATGTAACTGTACAAATCTAGACTCTAAAA
CAGTTTACATTGCCATGCTTGAGATAGCCTCAGCTTTCATCTGATACATTTTGTAAAACTCTTGTGCTAGGTAGTAAAATGGAGCCTCTACATTCTGTTG
TTCCTTGGCTGAGCACTCAAAGTACTCCAGACCGTGGGAAGAGGCAAATTCTGTGGGGAACTTCGGTGTGACAGTTCTTCGCTGCTCCAGGTCGAGTTTG
TTGCCAATCAGGACGCCGGGCAGAACGATTTCTGGCTTCTGGGAGCGAATCCTTTCCAGCCATTTGGAGCAACTGTGAAAGGATGGTTCACTGGTGAGGT
CGAACACCAGACACACGACAGAGGGGTGGTCCCAGTTCTTCTTCACGTGGTCGTAGAAGATCTCCTTCCCCGCAGAGTCAAAGATCAGCAGCTCCACGGT
GTCGTTGGTGTCGGGGATGATGACAGACTTCACACACACCTCCACACCTTCTGTCATGGTGTAACTCTTGGGGAAGTGGGAACCATCACTGTGGAACGTC
TGAACCAGCGCGCTTTTCCCCACTGTAGAATCCCCTGCTACGATACACTTAGCTCTGAGTACGACCATGCTTGCAATCCGTCGATACTTTCAGCGAAAAT
CTTTTAAAAACCCCAAGATGACTCACTTCGACGCGGTAAAAATTATAGCAGGGTGCACTTCACAAATACGAAAATCGAATATGTTTGAGAAGAAGGTACA
AACTACAAAATATCTAGAAACCAACGCTCTTATCAGGCTTTCTACCCAGCCTTCAAGAATATTCGCTGCACTACTTTCTATACCCGCGTCATAGACCCCG
GGGGTCGCCCATTAATACTGTGACCTGCTACCTTGAACCAACTTGACCTTGGATTTTCTTTCGCTCAGTCGACAAAACTAGACAAGATGCGAAACCTGGC
CAAATTCTAGTTCACAACTCCAAACGGTTGCTGAGATATTGCCAACTTTGCACTTCGGCACCGTCCAAGGCCCGTACGAGGGGCCATTTAGTGGTCCCAT
TATCCAATAAAATGTACTATTCTGGCCCTCTTTTTCTTGTTAACAATGATCATCAGTGCCTACTCTATCATTTAGAGTGATTTTTACTTAGTGTAAGGCT
TGTTTACGGCAAAAAGGGGGGGGGTGGCAACGGGGGTCTGACGGTGAAACAAACTGGTACATTTTAAGTGAGTCTACGTCAGTACTTGGTATACCAAGAA
AATTTGGTCGGAAATACCGCTGCTTGGAATTAATGGCCAATTCCCGTGTCTATTGAAGGTAGCAGAACACAGTTTTCGCCCTATGGGGAGTTCTATAGTT
AAGGCCCCCAAGGTGACTCACTTGGGCGCAGTAAAAATTATAGTAGGGTGCAACTAATATGTTGAAATTTAGGGTATAACCTGCAAAATGACTGAAAACA
AAAAAAAGTTATCGTTTTTTAACATCATGACGCCCTCTTTTATTTGGCCCTCTACTGGGGTCAACGGAACTGCAGCCGACTCACCCTGGTAGGCAGTTGC
GTAAGACAGGCGCATTTATACACTGAACGAGCAAACTTCAGAATCCTACTCATACGATCGAAAAGTCGACTCACTATACTGCCATACGGTAAAGTTTATG
CCTCGCTGCCTTTCATTTTAAAATGTATACAAACGCTACAAGATTTCGTCCGTACTATTTTCTGTACCCTACGTAATAGACTCCGGGGGTCGCGGATAAT
TACTGTGTTCTGGCCTTAAAAATGCTCGCTGTATATGCTAGTATGCAACAAAAACAGTCTAAAAGCTTGTTAAGGTGTGTAAAAGATAACTTGAAAATGA
TAGAAATCTGGATCTTAAAAATTATGTCAAAGTTCTGTGCTCGAAACTTTGTGTTAAATGAAATAAAAAGTTCCTCTTACACCTAAAACTACAAATGAAA
CAATATGTACATGTACATGTGGTAGTCTTCATTGGCAGCTTTTAAAGCTGTATGATAAATGTTGTGTACACTTCAACATTAGGCCACACCAAGTAAATTT
TATGGA


 
May 27, 2016. last modified
 
Copyright © Laboratory of Molecular Medicine, Sun Yat-Sen University, High Education Mega Center, Guangzhou 510006 China.