Home APASdb Home APAS Search APAS Browse BLAST Download Contact Us Help Citation
Analysis of genomic poly(A) sites
  Search For [ Example ] [ Tips ]
Sequence obtained by querying the dataset: ESTs/B.belcheri_454EST_xiamen-beihai-merged_adult
Strand:  Forwstrand Revcstrand  Display:  Fasta Numbered
Current detected sequences from to

>est_xb_1526:1-2206 No definition line found 
TCCATAAAATTTACTTGGTGTGGCCTAATGTTGAAGTGTACACAACATTTATCATACAGCTTTAAAAGCTGCCAATGAAGACTACCACATGTACATGTAC
ATATTGTTTCATTTGTAGTTTTAGGTGTAAGAGGAACTTTTTATTTCATTTAACACAAAGTTTCGAGCACAGAACTTTGACATAATTTTTAAGATCCAGA
TTTCTATCATTTTCAAGTTATCTTTTACACACCTTAACAAGCTTTTAGACTGTTTTTGTTGCATACTAGCATATACAGCGAGCATTTTTAAGGCCAGAAC
ACAGTAATTATCCGCGACCCCCGGAGTCTATTACGTAGGGTACAGAAAATAGTACGGACGAAATCTTGTAGCGTTTGTATACATTTTAAAATGAAAGGCA
GCGAGGCATAAACTTTACCGTATGGCAGTATAGTGAGTCGACTTTTCGATCGTATGAGTAGGATTCTGAAGTTTGCTCGTTCAGTGTATAAATGCGCCTG
TCTTACGCAACTGCCTACCAGGGTGAGTCGGCTGCAGTTCCGTTGACCCCAGTAGAGGGCCAAATAAAAGAGGGCGTCATGATGTTAAAAAACGATAACT
TTTTTTTGTTTTCAGTCATTTTGCAGGTTATACCCTAAATTTCAACATATTAGTTGCACCCTACTATAATTTTTACTGCGCCCAAGTGAGTCACCTTGGG
GGCCTTAACTATAGAACTCCCCATAGGGCGAAAACTGTGTTCTGCTACCTTCAATAGACACGGGAATTGGCCATTAATTCCAAGCAGCGGTATTTCCGAC
CAAATTTTCTTGGTATACCAAGTACTGACGTAGACTCACTTAAAATGTACCAGTTTGTTTCACCGTCAGACCCCCGTTGCCACCCCCCCCCTTTTTGCCG
TAAACAAGCCTTACACTAAGTAAAAATCACTCTAAATGATAGAGTAGGCACTGATGATCATTGTTAACAAGAAAAAGAGGGCCAGAATAGTACATTTTAT
TGGATAATGGGACCACTAAATGGCCCCTCGTACGGGCCTTGGACGGTGCCGAAGTGCAAAGTTGGCAATATCTCAGCAACCGTTTGGAGTTGTGAACTAG
AATTTGGCCAGGTTTCGCATCTTGTCTAGTTTTGTCGACTGAGCGAAAGAAAATCCAAGGTCAAGTTGGTTCAAGGTAGCAGGTCACAGTATTAATGGGC
GACCCCCGGGGTCTATGACGCGGGTATAGAAAGTAGTGCAGCGAATATTCTTGAAGGCTGGGTAGAAAGCCTGATAAGAGCGTTGGTTTCTAGATATTTT
GTAGTTTGTACCTTCTTCTCAAACATATTCGATTTTCGTATTTGTGAAGTGCACCCTGCTATAATTTTTACCGCGTCGAAGTGAGTCATCTTGGGGTTTT
TAAAAGATTTTCGCTGAAAGTATCGACGGATTGCAAGCATGGTCGTACTCAGAGCTAAGTGTATCGTAGCAGGGGATTCTACAGTGGGGAAAAGCGCGCT
GGTTCAGACGTTCCACAGTGATGGTTCCCACTTCCCCAAGAGTTACACCATGACAGAAGGTGTGGAGGTGTGTGTGAAGTCTGTCATCATCCCCGACACC
AACGACACCGTGGAGCTGCTGATCTTTGACTCTGCGGGGAAGGAGATCTTCTACGACCACGTGAAGAAGAACTGGGACCACCCCTCTGTCGTGTGTCTGG
TGTTCGACCTCACCAGTGAACCATCCTTTCACAGTTGCTCCAAATGGCTGGAAAGGATTCGCTCCCAGAAGCCAGAAATCGTTCTGCCCGGCGTCCTGAT
TGGCAACAAACTCGACCTGGAGCAGCGAAGAACTGTCACACCGAAGTTCCCCACAGAATTTGCCTCTTCCCACGGTCTGGAGTACTTTGAGTGCTCAGCC
AAGGAACAACAGAATGTAGAGGCTCCATTTTACTACCTAGCACAAGAGTTTTACAAAATGTATCAGATGAAAGCTGAGGCTATCTCAAGCATGGCAATGT
AAACTGTTTTAGAGTCTAGATTTGTACAGTTACATTCTGAGTCAAATCAGAAAATAATTCAAATTGATGATTTAGTAGAAAGGAGAAAAGTTTGTTAGTT
CGGTGTAAGAATATGAACTGAAAGTCTACCTGTATATTTCTTTCAAATTGAAATCTTATTGTATATTTGTGCGCAGAAATTTAGTTAGGAAGAAAGAGAA
ATGGTC


 
May 19, 2019. Last updated  
Copyright© Laboratory of Molecular Medicine, Sun Yat-Sen University, High Education Mega Center, Guangzhou 510006 China.