Home APASdb Home APAS Search APAS Browse BLAST Download Contact Us Help Citation
Analysis of genomic poly(A) sites
  Search For [ Example ] [ Tips ]
Sequence obtained by querying the dataset: ESTs/B.belcheri_454EST_xiamen-beihai-merged_adult
Strand:  Forwstrand Revcstrand  Display:  Fasta Numbered
Current detected sequences from to

>est_xb_1526:1-2206 No definition line found 
   1 GACCATTTCTCTTTCTTCCTAACTAAATTTCTGCGCACAAATATACAATAAGATTTCAATTTGAAAGAAATATACAGGTAGACTTTCAGTTCATATTCTT 100
 101 ACACCGAACTAACAAACTTTTCTCCTTTCTACTAAATCATCAATTTGAATTATTTTCTGATTTGACTCAGAATGTAACTGTACAAATCTAGACTCTAAAA 200
 201 CAGTTTACATTGCCATGCTTGAGATAGCCTCAGCTTTCATCTGATACATTTTGTAAAACTCTTGTGCTAGGTAGTAAAATGGAGCCTCTACATTCTGTTG 300
 301 TTCCTTGGCTGAGCACTCAAAGTACTCCAGACCGTGGGAAGAGGCAAATTCTGTGGGGAACTTCGGTGTGACAGTTCTTCGCTGCTCCAGGTCGAGTTTG 400
 401 TTGCCAATCAGGACGCCGGGCAGAACGATTTCTGGCTTCTGGGAGCGAATCCTTTCCAGCCATTTGGAGCAACTGTGAAAGGATGGTTCACTGGTGAGGT 500
 501 CGAACACCAGACACACGACAGAGGGGTGGTCCCAGTTCTTCTTCACGTGGTCGTAGAAGATCTCCTTCCCCGCAGAGTCAAAGATCAGCAGCTCCACGGT 600
 601 GTCGTTGGTGTCGGGGATGATGACAGACTTCACACACACCTCCACACCTTCTGTCATGGTGTAACTCTTGGGGAAGTGGGAACCATCACTGTGGAACGTC 700
 701 TGAACCAGCGCGCTTTTCCCCACTGTAGAATCCCCTGCTACGATACACTTAGCTCTGAGTACGACCATGCTTGCAATCCGTCGATACTTTCAGCGAAAAT 800
 801 CTTTTAAAAACCCCAAGATGACTCACTTCGACGCGGTAAAAATTATAGCAGGGTGCACTTCACAAATACGAAAATCGAATATGTTTGAGAAGAAGGTACA 900
 901 AACTACAAAATATCTAGAAACCAACGCTCTTATCAGGCTTTCTACCCAGCCTTCAAGAATATTCGCTGCACTACTTTCTATACCCGCGTCATAGACCCCG 1000
1001 GGGGTCGCCCATTAATACTGTGACCTGCTACCTTGAACCAACTTGACCTTGGATTTTCTTTCGCTCAGTCGACAAAACTAGACAAGATGCGAAACCTGGC 1100
1101 CAAATTCTAGTTCACAACTCCAAACGGTTGCTGAGATATTGCCAACTTTGCACTTCGGCACCGTCCAAGGCCCGTACGAGGGGCCATTTAGTGGTCCCAT 1200
1201 TATCCAATAAAATGTACTATTCTGGCCCTCTTTTTCTTGTTAACAATGATCATCAGTGCCTACTCTATCATTTAGAGTGATTTTTACTTAGTGTAAGGCT 1300
1301 TGTTTACGGCAAAAAGGGGGGGGGTGGCAACGGGGGTCTGACGGTGAAACAAACTGGTACATTTTAAGTGAGTCTACGTCAGTACTTGGTATACCAAGAA 1400
1401 AATTTGGTCGGAAATACCGCTGCTTGGAATTAATGGCCAATTCCCGTGTCTATTGAAGGTAGCAGAACACAGTTTTCGCCCTATGGGGAGTTCTATAGTT 1500
1501 AAGGCCCCCAAGGTGACTCACTTGGGCGCAGTAAAAATTATAGTAGGGTGCAACTAATATGTTGAAATTTAGGGTATAACCTGCAAAATGACTGAAAACA 1600
1601 AAAAAAAGTTATCGTTTTTTAACATCATGACGCCCTCTTTTATTTGGCCCTCTACTGGGGTCAACGGAACTGCAGCCGACTCACCCTGGTAGGCAGTTGC 1700
1701 GTAAGACAGGCGCATTTATACACTGAACGAGCAAACTTCAGAATCCTACTCATACGATCGAAAAGTCGACTCACTATACTGCCATACGGTAAAGTTTATG 1800
1801 CCTCGCTGCCTTTCATTTTAAAATGTATACAAACGCTACAAGATTTCGTCCGTACTATTTTCTGTACCCTACGTAATAGACTCCGGGGGTCGCGGATAAT 1900
1901 TACTGTGTTCTGGCCTTAAAAATGCTCGCTGTATATGCTAGTATGCAACAAAAACAGTCTAAAAGCTTGTTAAGGTGTGTAAAAGATAACTTGAAAATGA 2000
2001 TAGAAATCTGGATCTTAAAAATTATGTCAAAGTTCTGTGCTCGAAACTTTGTGTTAAATGAAATAAAAAGTTCCTCTTACACCTAAAACTACAAATGAAA 2100
2101 CAATATGTACATGTACATGTGGTAGTCTTCATTGGCAGCTTTTAAAGCTGTATGATAAATGTTGTGTACACTTCAACATTAGGCCACACCAAGTAAATTT 2200
2201 TATGGA 2206

 
May 19, 2019. Last updated  
Copyright© Laboratory of Molecular Medicine, Sun Yat-Sen University, High Education Mega Center, Guangzhou 510006 China.