Branchiostoma belcheri haploid   [login][regist]
Home Lancelet Home Gene Search BLAST Genome Browse Download softwares ChangeLog Contact Us Help
 
Genome Project for Chinese Lancelet
 Search For [ Example ] [ Tips ]
Sequence obtaned by the ids from the ncRNA-dataset: 'Danio.rerio_Zv9.62.ncRNA'
Strand:  Forwstrand Revcstrand  Display:  Fasta Numbered
Current detected sequences from to
 
[1]. >ENSDART00000128920 ncrna:miRNA scaffold:Zv9:Zv9_scaffold3494:181821:181904:-1 gene:ENSDARG00000091283  Required:1-84bp in 1-84bp
TACAGCCATACCACCCTGGAAATGCCCGATCTCATCTGAACTCGGAAGTAAAGCAGGGTCGGGCCTGGTTAGTACTTGGATGGG

June 28, 2016. last modified
 
 
 
Published Papers Resear Directions Tools & Resources Others    
Bioinformatics
Amphioxus
Zebrafish
Drug Design
Conotoxin
Human MHC
Amphioxus Immunity
Zebrafish Immunity
Drug Design
Conotoxin
Human MHC
Bioinformatics
Softwares & Tools
Data & Download
APASdb Database
 
 
 
About Supervisor
Laboratory Site
 
 
 
 
   


Copyright©Laboratory of Molecular Medicine, Sun Yat-Sen University, High Education Mega Center, Guangzhou 510006 China.